|
Sangon Biotech
universal primers for the 16s rrna gene Universal Primers For The 16s Rrna Gene, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/primers+targeting+the+16s+rrna+gene/pm40314779-62-2-26 Average 90 stars, based on 1 article reviews
universal primers for the 16s rrna gene - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
universal primer pair targeting the bacteria/archaea 16s rrna gene variable region v4 Universal Primer Pair Targeting The Bacteria/Archaea 16s Rrna Gene Variable Region V4, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/universal+primer+pair+targeting+the+bacteria+archaea+16s+rrna+gene+variable+region+v4/pm40013791-82-13-37 Average 90 stars, based on 1 article reviews
universal primer pair targeting the bacteria/archaea 16s rrna gene variable region v4 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
pcr amplification of the 16s rrna gene region with universal primers (27f: agagtttgatcctggcctca, 1492 r: ggttaccttgttacgactt) Pcr Amplification Of The 16s Rrna Gene Region With Universal Primers (27f: Agagtttgatcctggcctca, 1492 R: Ggttaccttgttacgactt), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/16s+rrna+gene+amplification/pmc11559365-303-15-25 Average 90 stars, based on 1 article reviews
pcr amplification of the 16s rrna gene region with universal primers (27f: agagtttgatcctggcctca, 1492 r: ggttaccttgttacgactt) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Macrogen
16s rrna gene-specific universal primers 16s Rrna Gene Specific Universal Primers, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/16s+rrna+primers/pm39103503-74-8-14 Average 90 stars, based on 1 article reviews
16s rrna gene-specific universal primers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
primers targeting universal groupspecific 16s rrna gene Primers Targeting Universal Groupspecific 16s Rrna Gene, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/Custom+Primer%2C+Special+Handling/pm38925433-71-44-44 Average 90 stars, based on 1 article reviews
primers targeting universal groupspecific 16s rrna gene - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Hokkaido System Science Co
universal primer for bacterial 16s rrna gene Universal Primer For Bacterial 16s Rrna Gene, supplied by Hokkaido System Science Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/primers+for+18s+rrna/pmc11099601-120-4-7 Average 90 stars, based on 1 article reviews
universal primer for bacterial 16s rrna gene - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
HiMedia Laboratories
partial sequencing of 16s rrna gene using universal primers 27f/1492r Partial Sequencing Of 16s Rrna Gene Using Universal Primers 27f/1492r, supplied by HiMedia Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/partial+sequencing+of+16s+rrna+gene+using+universal+primers+27f+1492r/10__30574_slash_wjbphs__2024__18__2__0234-58-9-23 Average 90 stars, based on 1 article reviews
partial sequencing of 16s rrna gene using universal primers 27f/1492r - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Nextera AS
universal primers for the 16s rrna gene Universal Primers For The 16s Rrna Gene, supplied by Nextera AS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/universal+primers+for+the+16s+rrna+gene/pmc11124520-153-35-28 Average 90 stars, based on 1 article reviews
universal primers for the 16s rrna gene - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
universal 16s rrna gene forward primers (515 f) Universal 16s Rrna Gene Forward Primers (515 F), supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/16s+rrna+gene+primers/pm38650043-213-12-7 Average 90 stars, based on 1 article reviews
universal 16s rrna gene forward primers (515 f) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
pcr using universal primers targeting the hyper variable region v4 of the 16s rrna gene (251) Pcr Using Universal Primers Targeting The Hyper Variable Region V4 Of The 16s Rrna Gene (251), supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/universal+16s+rrna+gene+primer/primers+targeting+the+16s+v3+and+v4+region/10__24072_slash_pcjournal__370-49-6-26 Average 90 stars, based on 1 article reviews
pcr using universal primers targeting the hyper variable region v4 of the 16s rrna gene (251) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |